Full HTML 01 V1 I2

The Approaching Therapy Targeting Alzheimer’s disease using Kefir grain and Mesenchymal Stem Cells


Ola SayedM.Ali1, Laila Ahmed.R2, Badawi A.M.3 and Mai M.Anwar4*
1. Department of Biochemistry, Faculty of Pharmacy, Al-Azhar University, Egypt
2. Department of Biochemistry and Molecular Biology, Faculty of Medicine, Cairo University, Egypt
3. Department of Biochemistry, National Organization for Drug Control and Research (NODCAR), Egypt

Abstract

Background: Alzheimer’s disease (AD) is characterized by the accumulation of amyloid plaques and neurofibrillary tangles accompanied by cognitive dysfunction affecting the quality of life of patients. Objective: to investigate the effects of MSCs and/or milk Kefir grains in Alzheimer’s disease induced in female albino rats.Materials and Methods: sixty female albino rats were divided into equal six groups (ten rats each): group1: healthy control; group 2: LPS-induced AD; group 3: LPS- induced AD in rats received single intravenous injection of MSCs; group 4: LPS-induced AD in rats received milk Kefir; group 5: LPS-induced AD in rats which received asingle intravenous injection of MSCs with a daily milk Kefir grain administration for a month; group 6: the rats of this group received kefir for one week prior to the induction of AD followed by a single intravenous Infusion of MSCs with a daily milk Kefir grain administration for a month. AD was assessed by T maze behavioral test month after induction. Brain tissue was collected for monitoring BDNF, Bax, Bcl-2and seladin-1 gene expression with the measurement of TNF-α, IL-10 and tissue cholesterol. Plasma lipid profile, GSH and MDA were also determined.Results: revealed that significant elevation of lipid profile and oxidative stress in association with LPS-induction. BDNF, Bcl-2and seladin-1 gene expression were significantly reduced in AD while Bax mRNA gene was significantly increased. Administration of Kefir and /or MSCs suppressed LPS –induced AD. Conclusion: the pre and co-administration of Kefir with MSCs can function as a potent modulator attenuating the underling pathological process which results in progressing of brain damage.

Keywords: Alzheimer’s disease, stem cell, Kefir.

 

Introduction

Alzheimer’s disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia in the world. AD affects more than 20% of individuals over 80 years of age, and epidemiological data predict that by 2050 over 35 millions of people will be affected, with a significant social and economic burden 1. Clinically, AD is typically characterized by progressive memory loss, impairment of other cognitive functions and inability to perform activities of daily living. The earliest clinical stage of AD is defined as mild cognitive impairment (MCI) and it is characterized by impairment in memory and/or others cognitive domains preserving the functional abilities, with an annual conversion rate from MCI to AD of 15%. To date, the available therapeutic agents are only able to slow disease progression, with limited benefits 2.

Pathologically, AD brain is characterized by two major protein abnormalities: extracellular amyloid-β (Aβ) deposition and intra- cellular neurofibrillary tangles (NFT) formation, both ultimately leading to extensive neuronal degeneration. Aβ peptides derive from sequential cleavage of membrane-spanning amyloid precursor protein (APP) by beta-site APP cleaving enzyme 1 (BACE1) and the γ-secretase complex containing the presenilin (PSEN) proteins in the catalytic domain. The NFT pathogenesis is less understood, however it is known that NFT derive from abnormal aggregation of hyperphosphorylated microtubule associated tau protein. However, several other pathological mechanisms are being investigated as potential contributors to AD pathology 3,4,5,6,7. Inflammation has been implicated in Alzheimer’s disease pathogenesis for over a decade, and increasing evidence suggests that abnormalities in cholesterol homeostasis could have an important role. Similarly, many of the contributory factors in atherogenesis have emerged as potential contributors in Alzheimer’s disease 8.CNS inflammation in AD is characterized by reactive microglia, elevated IL-1 and complement factors 9.AB aggregates can stimulate oxidation in multiple ways: including neuronal H2O2 production 10 and free radical production 11. Both oxidative damage 12, and inflammation 9,10 begin early in AD accompanying amyloid accumulation and neurodegeneration.

Therapeutic potentials of stem cells in several brain disorders are enticing researchers to apply stem cell-based therapies 12,13,14. Neural stem cells have been shown to rescue memory impairment in AD model mice by releasing brain-derived neurotropic factor (BDNF) 15. Also, bone marrowderived mesenchymal Stem Cells (BM-MSCs) modulate immune response with alleviated AB deposition and memory deficits in AD model mice 16.However, it would almost be impossible to perform intravenous transplantation of neural stem cells and BM-MSCs.

Kefir is a beverage consisting of gelatinous and irregular grains formed by a consortium of yeasts and lactic acid bacteria which causes acid-alcoholic fermentation in sugar and milk solutions 17.This micro flora is embedded in a resilient polysaccharide matrix, called kefiran, composed of branched chains of glucose and galactose as metabolic products of souring milk lactose and other substrates 18. There are approximately 30–50 bacteria and yeast strains living together in kefir grains, although this number may change depending on the culture media used and the country of the grain source 19. Kefir can be considered to be a probiotic resource as it can improve a variety of health conditions besides its nutritional status. There are several studies investigating immune-modulatory, pathogenic barrier, anti-neoplastic, digestive effects caused by kefir intake and anti-inflammatory 17.Although several chemical substances and drugs have been used in treatment of Alzheimer’s disease, kefir has not been used till now.

The aim of this study was to investigate the effects of MSCs and /or Kefir in Alzheimer’s disease induced in female albino rats.

 

Materials and Methods

Preparation of bone marrow (BM)-derived mesenchymal stem cells from rats:

Bone marrow was harvested by flushing the tibiae and femurs of 6 weeks old female white albino rats with Dulbecco’s modified Eagle’s medium (DMEM, GIBCO/BRL) supplemented with 10% fetal bovine serum (GIBCO/BRL). Nucleated cells were isolated with a density gradient [Ficoll/Paque (Pharmacia)] and re-suspended in complete culture medium supplemented with 1% penicillin–streptomycin (GIBCO/BRL). Cells were incubated at 37°C in 5% humidified CO2 for 12–14 days as primary culture or upon formation of large colonies. When large colonies developed (80–90% confluence), cultures were washed twice with phosphate buffer saline (pH 7) and the cells were trypsinized with 0.25% trypsin in 1mM EDTA (GIBCO/BRL) for 5 min at 37°C. After centrifugation, cells were re-suspended in serum supplemented medium and incubated in 50 cm2 culture flasks (Falcon). The resulting cultures were referred to as first-passage cultures (Alhadlaq and Jeremy, 2004). Cells were identified as being MSCs by their morphology, adherence and their power to differentiate into osteocytes and chondrocytes 20.

Preparation of kefir: 

Milk kefir grains were used as a probiotic live active culture in organic powdered milk purchased from Cultures for Health, USA (17978S, Grasle Rd.Ore.City OR 97045). Freezedried kefir grains (20mg) were inoculated to 100 ml of pasteurized milk. All inoculated milk was incubated at 20°C for 24 h. At the end of fermentation, the milk was filtered to remove kefir grains. The milk kefir grains were then freeze-dried and stored at 4°C until required 21

Animals andExperimental Design:

The study was carried on sixty female albino rats weighing 150 to 200 g. Rats were bred and maintained in an air- conditioned animal house with specific pathogen-free conditions, and were subjected to a 12:12-h day light/darkness and allowed unlimited access to chow and water. All the ethical protocols for animal treatment were followed and supervised by the animal facilities, Faculty of Medicine, Cairo University. All the animals included in the experiment received approval from the Institutional Animal Ethics Committee.To achieve the ultimate goal of this study, a total of sixty female albino rats were randomized and divided into equal six groups (ten rats each):

Group I (control): Control normal group

Group II (AD): the rats of this group were injected intraperitoneally (I.P.) with 0.56mg / kg body weight of LPS dissolved in 1 ml of sterile PBS (PH 7) to induce AD as a modified  single dose previously published by 22.

Group III(AD+MSCs):  LPS-induced AD in rats which received MSCs (Which were processed and cultured for 14 days, in a single dose of 1 μL (500 x103/μL) cells 23.

Group IV (AD + Kefir): LPS-induced AD in rats received 3.5ml/kg body weight of milk kefir  grain by oral gavage once daily for a month as a modified previous dose response previously published by 21.

Group V (AD + MSCs + Kefir): LPS-induced AD in rats received a single intravenous injection (IV) of MSCs simultaneously with milk kefir grain once daily for a month as mentioned above.

Group VI (Kefir + AD +MSCs + Kefir): LPS-induced AD in rats received milk kefir grain for one week prior to the induction of AD then followed by single intravenous Infusion of MSCs simultaneously with daily milk kefir administration for a month.

 

Behavior study through time consumed in T-Maze test:

Behaviour study was done 1hr after the last dose of the given treatments. On the day of testing, rats were transported to the testing facility (Behavioural Lab, Faculty of Medicine, Cairo University). A 30 min period was allowed prior to testing to adapt to the environment and to minimize the effect of stress due to transfer.

Apparatus setting and Animal preparation:

The automatic modified T-maze apparatus is constructed of white plastic runways with 25cm high walls. The maze is partitioned off into 6 areas (A1, A2, S1, S2, P1, P2) by sliding doors (s1, s2, s3, a1, a2, p1, p2) that can be automatically opened downward. The stem of the T is composed of two arms.The end of each arm is equipped with a pellet dispenser that automatically provides a sucrose pellet (20 mg, Formula 5 TUT, Test Diet, Richmond, IN, USA) as a reward24. Two rats per cage in a temperature-controlled room (23±2°C) with a 12-h light/dark cycle (lights on at 7:00 AM), according to guidance and protocols established by local Animal Care and Use Committee

Transfer all the cages containing rats into the soundproof room from the housing room at least thirty min before the first trial begins. All the experiments should be always performed during the same time period (e.g., 9:00 AM to 6:00 PM) with slight modification of (Shojiet al., 2012).Pre-training sessions are required followed by either a forced alternation task or left-right discrimination task.

Forced alternation task

In the forced alternation task, each trial consists of a forced choice run followed by a free choice run. The rat is allowed to enter the area and to consume the pellet. When the rat has eaten the pellet, the door near the food tray of the arm that the rat currently stays is opened. Then, the rat approaches the door neighboring the start box, so it can return to the start box. Following the forced-choice run, the free-choice run begins. The rat is allowed to choose between the two arms. If the rat enters the opposite arm that it was forced to choose in the forced-choice run, its response is considered to be “Correct” and the rat receives a sucrose pellet. If the rat goes to the same arm as that visited in the forced-choice task, the rat is opened, and the rat can return to the start box. In these trials, time consumed for each rat in each session was measured with slight modification of 24.

At the end of the experiment,animals were anesthetized with sodium phentobarbital (60 mg/kg),blood samples were collected in heparinized tubes from the retro-orbital venous plexus and plasma were carried out byusing cooling centrifugation at 3000 rpm for 10 min and stored at -20oCuntil use. After collection of blood samples, all animals were sacrificed by decapitationand brains were rapidly removed and cut into 2 symmetrical halves by midline incision. One part was removed and immediately immersed in 10% buffered formalin for histopathological examinations and the other half was stored at –80°C for further biochemical analysis.

 

Biochemical Analysis:

Preparation of brain tissue homogenate:

The brain tissue was homogenized in 10 % PBS buffer (pH 7) for 10 min and centrifuged for 20 min at 4,000 rpm. The clear supernatant obtained was then divided into three portions and were kept frozen at -80 °C till analysis.

Real-time quantitative analysis forBDNF, Bax, Bcl-2 and seladin1 gene expression: Brain total RNA was extracted from the homogenate using RNeasy purification reagent (Qiagen, Valencia, CA),cDNA was generated from 5 μg of total RNA extracted with 1 μl (20 pmol) antisense primer and 0.8 μl superscript AMV reverse transcriptase for 60 min at 37 °C. The relative abundance of mRNA species was assessed on an ABI prism 7500 sequence detector system (Applied Biosys- tems, Foster City, CA). PCR primers were designed with Gene Runner Software (Hasting Software, Inc., Hasting, NY) from RNA sequences from Gene Bank (Table 1). All primer sets had a calculated annealing temperature of 60°. Quantitative real time-PCR was performed in duplicate in a 25-μl reaction volume consisting of 2X SYBR Green PCR Master Mix (Applied Biosystems), 900 nM of each primer and 2–3 μl of cDNA. Amplification conditions were 2 min at 50°, 10 min at 95° and 40 cycles of denaturation for 15 s and annealing/extension at 60° for 10 min. Data from real-time assays were calculated using the v1·7 Sequence Detection Software from PE Bio- systems (Foster City, CA). Relative expression was calculated using the comparative Ct method as previously described. All values were normalized to the B-actin gene and reported as fold change over background levels detected in AD.

 Table 1: Sequence of the primers used for real-time PCR Primer

Bax

 

Forward primer: 5’GTTGCCCTCTTCTACTTTG 3’

Reverse primer: 5’AGCCACCCTGGTCTTG3’

BDNF

 

Forward primer: 5’ACC CTG AGT TCC ACC AGG TG3’

Reverse primer: 5’TGG GCG CAG CCT TCA T3’   

Bcl-2 Forward 5′ CGGGAGAACAGGGTATGA 3′

Reverse 5′ CAGGCTGGAAGGAGAAGAT 3′

seladin-1  Forward primer: 5’ATCGCAGCTTTGTGCGATG3’

 Reverse primer: 5’CACCAGGAAACCCAGCGT3’

β-actin  Forward primer :5’CCAGGCTGGATTGCAGTT3’

Reverse primer: 5’GATCACGAGGTCAGGAGATG3’

 

 

Determination of IL-10 and TNF-α level in brain tissue:

The second portion of Brain Homogenate were used in the determination of tissue IL-10 and

TNF-α by commercia1lly available Enzyme-linked immunosorbent assays (ELISA) kits supplied from Q &D system Quatin USA according to the manufacturer`s instructions.Protein concentrations were determined by 25 with bovine serum albumin as a standard.

Determination of brain tissue cholesterol Level:

The third portion of Brain Homogenate was used in the determination of tissue total cholesterol level;Kit wassupplied from Cell Bio Labs. Protein concentrations were determined by 25 with bovine serum albumin as a standard.

Analysis of brain histopathology:

The obtained tissue sections were collectedon glass slides, deparaffinized, and stained by hematoxylin and eosin (H&E). Examination was performed by light microscopy 26.

Statistical analysis

Data were expressed as mean ± SE. Significant differences were determined by using ONE WAY ANOVA and post-hoc tests (Duncan’s multiple comparison test). P< 0.05 was considered significant. Data were statistically analyzed using the statistical package for social science software version18 (SPSS, Chicago, IL, USA). 

RESULTS

Behavior study through time consumed in T- maze test:

In the current investigation, administration of LPS (0.56 mg/kg) resulted in a significant increase in the time spent by the rats when compared with the negative control group. Treatment with MSCs and/or milk Kefir grain resulted in significant protection against LPSinduced changes (p <0.05) and significantly decreased the time spent by rats in T-maze test. The greatest decrease in time spent by rats was seen in the prophylactic group VI (Kefir +AD+MSCs+Kefir). This indicated a major memory recovery. All Groups were significantly different from control values (p < 0.05) as shown in figure 1.

(n =10)

Figure 1: Mean SE time consumed in T- Maze. The small letter means insignificant between different treated groups using one-way ANOVA at P< 0.05.Anova was employed followed by Duncan’s multiple comparison test at P< 0.05

 

Effects of MSCs and/or milk Kefir on BDNF, Bax, Bcl-2 and seladin-1 relative expression on Brain tissue:

Concerning gene expression, there was a significant decrease in BDNF, Bcl-2, seladine-1 with an increase in Bax relative expression of the LPS-induced AD compared to the control group (P<0.05) as shown in (table 2).Following MSCs injection and /or milk Kefir grain administration, there was an improvement in the reduction level of tissue BDNF, Bcl-2,seladine-1 with decrease in Bax relative expression with variations in the percent of change among the groups. Also a synergistic effect was potentially noticed by the pre and co-administration of milk kefir with MSCs in LPS challenged rats as shown in (figures 2a, 2b).

Table 2: The % change of MSCs and/or milk Kefir grain on tissue BDNF, Bax, Bcl-2

and seladine-1 Relative Expression of LPS- induced AD in albino rats:

Groups\ Parameters BDNF %Change BAX %Change Bcl-2

% Change

seladine-1

% change

I– Negative control
II– Positive Control (AD) -89 802      -89 -89
III– AD+ MScs -65 351   -54 -66
IV– AD+ Kefir -73 378    -70 -70
V– AD+ MScs +Kefir -48 229    -37 -23
VI-Kefir +AD+MScs+Kefir -46 343     -54 -45

 

– The % of change was calculated corresponding to the Negative control group.

– Each value represent the mean of ten rats(n =10).

Effects of MSCs and/or milk Kefir on TNF-α and IL-10levels of Brain tissue:

TNF-αand IL-10 level were estimated in brain supernatant of all the studied six groups. As shown in table 3 and figures (3a and 3b), levels of TNF-α were significantly increased with a simultaneous decrease in IL-10 level of the LPS –induced AD when compared to control group (p < 0.05), indicating that LPS induced a neuroinflammatory process which may contribute to AD.

Effects of MSCs and/or milk Kefir on cholesterol levelsofBrain tissue:

The results of the present study show a significant increase in the tissue cholesterol level in the LPS- induced AD group when compared with the negative control group with a significant decrease in tissue cholesterol level after the administration of milk kefir grain and/or MScs as shown in table3 and figure 3.

 

Table 3: The % change of MSCs and/or milk Kefir grain on brain tissue TNF-α, IL-10and tissue cholesterol levels of LPS- induced AD in albino rats:

Groups     \ Parameters TNF-α %Change IL-10

%Change  

Total Cholesterol

 % Change

I-Negative control
II– Positive Control (AD ) 295 -54 204
III-AD+ MSCs 194 -16 87
IV-AD+ Kefir 197 -30 105
V– AD+ MSCs +Kefir 148 -12 61
VI-Kefir +AD+MSCs+Kefir 192 -22 96

 

– The % of change was calculated corresponding to the control group.

– Each value represent the mean of ten rats (n =10).

 

Effects of MSCs and/or milk Kefir on plasma lipid profile:

It was found a significant increase in plasma total cholesterol level, LDL and triacylglycerol with a decrease in the plasma HDL of the LPS-induced AD. Kefir and/or MSCs administration cause a decrease in total plasma cholesterol, LDL and triacylglycerol level with an improvement in the reduction level of HDL with variations among the treated groups which indicate the efficacy of milk Kefir grain and/or MScs as antihyperlipdemic and antihypercholesterolaemia.

 

Figure(2a): Mean ± SE (n=10) of MSCs and/or milk Kefir grain on brain BDNF Relative Expression of LPS- induced AD in Albino Rats.

Figure(2b):Mean ± SE (n=10) of MSCs and/or milk Kefir grain on brain Bax Relative Expression of LPS- induced AD in Albino Rats.

 

Figure(3a):Mean ± SE (n=10) of MSCs and/or milk Kefir grain on brain  IL-10(pg/mg protein) of LPS- induced AD in Albino Rats.

Figure(3a):Mean ± SE(n=10)  of MSCs and/or milk Kefir grain on  brain tissue cholesterol (mg/gm tissue) of LPS- induced AD in Albino Rats.

Table 4: The effect of MScs and/or milk Kefir grain on plasma Total Cholesterol (T-CHO), HDL- Cholesterol (HDL-CHO), Triglycerides (TG) and LDL- Cholesterol (LDL-CHO) levels(mg/dl± SE ) and % Change of LPS induced AD in albino rats.
    Parameters

 

 

 

Groups

Total Cholesterol     HDL-Cholesterol       Triglycerides LDL-Cholesterol  
 Mean       ± SE    %     Change   Mean       ± SE    %     Change Mean       ± SE    %     Change    Mean       ± SE               %  

  Change

Control 133.9        ±1.64 a      —-  53.9      ±1.28 d —– 84.7       ± 3.37 a —- 63.1 ±2.99 a —-
AD 210.2    ±3.56 e 57   30.3     ±1.24 a -44 144.5 ±3.86 c 71 151.0 ±4.11 d 139
AD+MSCs 165.6   ±3.62 cd 24 40.0          ±0.53 c -26    110.4      ±1.70 b 30 103.5  ±3.55 c 64
AD+Kefir    170.8        ±2.91d 28   36.5         ±1.14 b -32 108.6   ±3.03b 28     112.6       ± 3.82 c 79
AD+MSCs+Kefir 142.2   ±1.29 b 6 38.5            ±0.96 bc -29 90.9

±4.02 a

7 85.5

±1.42 b

36
Kefir+AD+

MSCs+Kefir

162.1

± 2.13 c

21 35.8     ±1.08 b -34 91.3      ±2.29 a 8  108.1        ±1.94 c 71

– Values presented as Mean ±SE (n =10)

– % change was calculated corresponding to Control group.

-The same small letter means insignificant difference among treated groups using one-Way ANOVA at P>0.05 followed by Duncan-multiple comparison.

Effect of kefir and/or MSCs on plasma lipid peroxidation andreduced glutathione:

 

An observed increase in plasma MDA Level associated with marked decrease in plasma GSH level was found in LPS-induced AD. The treatment of LPS challenged rats with kefir and /or MSCs produced a significant attenuation in the induced oxidative stress. The obtained results also revealed that, the transplantation of MSCs attenuated the oxidative stress induced by LPS challenge and this attenuating effect was potentially enhanced by the pre and co-administration of milk kefir with MSCs by decreasing the MDA level with improvement in the reduction level of GSH in LPS-induced AD as shown in (table 5).

 

Table 5: The effect of MSCs and/or milk Kefir grain on MDA level (nmol/ml) and GSH (ug/ml) content and % Change of LPS induced AD in Albino Rats:

 

Groups     \ Parameters MDA

Mean ± SE

 

 % Change

GSH

Mean ± SE

 %Change
I– Negative control 1.12±0.061 a 50.75± 1.086 d
II-AD(Positive Control ) 11.17±0.396 d 897 21.96 ±1.04 a -57
III-AD+ MSCs 5.46± 0.321 c 388 32.34 ± 1.09 b -36
IV-AD+ Kefir 4.52± 0.317 c 304 35.44± 1.29bc -30
V – AD+ MSCs +Kefir 3.30± 0.2112 b 195 37.38± 1.68 c -26
VI-Kefir +AD+MSCs+Kefir

(Prophylaxis Status)

4.58±0.453  c 309 36.86±1.78 c -27

– Values presented as Mean ±SE(n=10)

-% change was calculated corresponding to Control group.

-The same small letter means insignificant difference among treated groups using one-Way ANOVA at P˂ 0.05 followed by Duncan-multiple comparison.

 

Histopathological examination of brain tissues:

Concerning the histopathological findings, sections of normal rat showed cerebral cortex exhibiting normal neurons surrounded by nerve fibers and blood vessels (Figure 4). In LPSinduced AD rats, multiple plaques formed of lamellated fibrils were observed. Such plaques were surrounded by multiple apoptotic nuclei (Figure 5).Severe inflammation with congestion blood vessels with deposits of (amyloid) material in their wall and extravasated red blood corpuscles around as compared to the normal control group (Figures 6). Administration of MSCs showed less dense plaques, multiple and less prominent apoptotic nuclei (Figure 7). On the other hand, milk Kefir Grain revealed disappearance of multiple plaques, some dense plaques with few apoptotic nuclei (Figure 8). MSCs and milk Kefir grain administration lead to slight focal plaques formation, multiple apoptotic nucli with congestion in blood vessels (Figure 9). On the prophylaxis group,there was a slight focal plaques formation, few multiple apoptotic nucli with less diffused congestion in blood vessels (Figure 10).

 

Figure 4: Histopathological examination of control group shows normal neuron cells with nevefibres Figure 5: Histopathological examination of Alzheimer disease   induced model showed multiple plaques formed of lamellate fibrils surrounded by multiple apoptotic nuclei.

 

 

Figure 6: Histopathological examination of Alzheimer disease induced model showed severe inflammation with blood vessels with deposits of (amyloid) material in their wall. Figure 7: Histopathological examination of AD + MSCs group- showed less dense plaque formation with apptoticnucli and congestion in the blood vessels were observed.

 

 

Figure 8:Histopathological examinations of AD + milk Kefir Grain-showed slight multiple plaques formation, apoptotic nucli with slight congestion in blood vessels.

Figure 9:Histopathological examination of AD +MSCs +kefir- showed that there was a slight focal plaques formation, multiple apoptotic nucli with congestion in blood vessels.

 

Figure 10: Histopathological examination of Kefir +AD+MSCs+Kefir- showed that there was a slight focal plaques formation, no multiple apoptotic nucli with slight congestion in blood vessels.

 

Discussion

Stem cells have therapeutic effects using regeneration in addition to substitution of cells and tissues by themselves. Bone marrow–derived stem cells contribute to cell turnover and repair various tissue types, including the brain 27

MSCs are commonly defined as bone marrow–derived fibroblast-like cells, which despite the lack of specific surface markers can be selected by their adherence characteristics in vitro and their ability to differentiate along the three principal mesenchymal lineages: Osteoblastic, adipocytic and chondrocytic 28,29. The therapeutic strategy of stem cell has two directions. One is to induce the activation of endogenous stem cell and the other is to regenerate injured cell or tissues through stem cell transplantation. Endogenous stem cells can be induced and can show neuro protective effects by Chemical compounds and factors stimulating stem cells such as allopregnanolone (Apα). Transplantation of stem cells has shown promise for improving functional recovery for Alzheimer’s disease. MSCs could promote survival, increase the metabolic activity and help to rescue the AD cell model in vitro. Culturing of human MSCs increase neprilysine expression and the Aβ-degrading enzyme, which lead to reduction of Aβ deposition, improving memory and alleviation of AD pathology in AD mouse models due to the reduction of pro inflammatory factors 30.

Kefir is a traditional beverage obtained by the fermentation of milk with kefir grains containing awide diversity of lactic- and acetic-acid bacteria plus yeasts 31, 32. Beyond that the drink’s inherent high nutritional value as a source of proteins and calcium, kefir is considered a functional food. The health benefits associated with kefir consumption may be exerted by the presence of the microorganisms themselves and/ or by other bioactive components.

The present study was based on single injection of endotoxin lipopolysacrides(LPS) to induce

Alzheimer’s disease 22. It was found that systemic injection of LPS induces neuroinflammatory response resulting in reduction of neurogensis but administration of anti-inflammatory drug or activation of microgilia prevents LPS from inducing down regulation of neurogensis 33,34. In the present work, a behavior study through time consumed in T-maze test was done to give a clear demonstration on how the behaviour of the rats was changed after single injection with LPS. In maze test, there was a clear difference between rats of negative control group and those LPS-induced AD. This difference was demonstrated in the time consumed by the rats in thesetwo groups to reach the end of the maze.

It was found that the healthy rats in group I consumed the least time, while rats in group II consumed the longest time among the other groups due to manipulations occurred in the brain as a result of LPS injection. It was also shown that best time consumed among the other groups was obtained by a group VI, which was clearly progressing to be close to the time consumed by group I. Treatment of AD rat model with BM-MSCs promoted microglial activation, rescued cognitive impairment plus reduced Aβ and tau pathology in rat’s brain. This agrees with the work of 35, who strongly suggested that intra cerebral BMMSCs transplantation not only reduces amyloid load and tau phosphorylation in the brain, but also prevents cognitive decline and memory impairment; this occurs by activation of an endogenous microglial population with an alternative phenotype that has neuroprotective effects. We showed that MSCs stimulate microglia polarization towards M2 phenotype. This may be mediated by the immunosuppressive effects of MSCs. In this respect, it is of interest that we have shown increased IL-10 expression after MSCs transplantation 36.These findings suggest that lesion repair is associated with an anti-inflammatory environment and that the immunosuppressive capacity of MSCs 37

Administration of kefir also improves both the behavioral and molecular levels of the induced AD rat models through various mechanisms. It was demonstrated that probiotics decrease the accumulation of white blood cells and TNF-α, thus diminishing the severity of inflammation. It was reported that probiotics decrease the production of pro-inflammatory cytokines by inhibiting main regulators of inflammation plus suppression of bacterial infection by inhibiting the adhesion and /or over growth of bacteria 38

Alzheimer’s disease is characterized by the death of cells in the hippocampus and the frontal cortex secondary to chronic inflammation neural cell death occurs by necrosis or apoptosis. In necrosis, there is often a definitive temporal cause of the death of the cell. In apoptosis, the stimulus for death initiates a cascade of events that ultimately leads to cell destruction. The major executioners in apoptosis are proteases known as caspases. Upstream caspases are activated by cell-death signals (e.g TNF-α). The upstream caspases activate down- stream caspases that directly lead to the death of the cell. In the cascade of apoptosis, cytochrome T is released. Members of a group of proteins, known as the Bcl-2 and Bax family, are either antiapoptotic or apoptotic. The balance of these proteins is crucial in stimulating or blocking the release of cytochrome T and initiating or blocking the apoptosis cycle. In chronic neurodegenerative diseases, caspase mediated apoptotic pathways have the dominant role in causing cell dysfunction and cell death   35. 

Neurotrophins are a family of proteins that promote the survival and development the function of neurons. Among others, Bcl-2, Bax and BDNF inhibit death-inducing pathways and also activate a variety of cell survival pathways of neuron and oligodendrocyte 39,40and they are endogenously synthesized in the CNS, and they can be unbalanced in several neurological diseases. The administration of neurotrophins has been proposed as potential approach to the therapy of neural disorders such as Parkinson and AD 41,42,43. Regards the BDNF gene expression of the present study, there was a significant decrease in BDNF gene expression in the LPS-induced AD group when compared to the control group. It was found that BDNF is more highly expressed and widely distributed in the brain compared to other neutrophins, and its expression and growth promoting actions are critical for survival and plasticity of a variety of neurons 44. So a significant improvement was obtained in the reduction level of BDNF relative expression related to treated groups when compared with negative control group, Where MSCs are able to produce important neurotropic factors that support neuronal cell survival and promote nerve fiber regeneration at the sites of injury 45,46,46,47,48.Milk Kefir grain also improved the BDNF level by the microbiota found in kefir which act as a therapeutic target for cognitive enhancement by increasing the BDNF level and by dampening down of the effects of pro-inflammatory cytokines and oxidative stress 49,50.

In the present study, we focused on Bax and Bcl-2 as an important apoptotic factors(51). Bax gene expression was significantly increased in LPS-induced AD when compared with negative control group. On the other hand, the Bcl-2gene expression was significantly decreased in LPS-induced AD when also compared with the negative control group. On the contrary, group III, IV, V and VI showed a decrease in BAX relative expression with an improvement in the reduction level of Bcl-2relative expression. BM-MSCs transplanted via the portal vein inhibit apoptosis by, higher levels of Bcl-2protein, and lower levels of Bax 52. The milk-treated groups, on the other hand, showed the same response, an up regulation of Bcl-2and a down regulation of Bax. These results were suggested to be proven by 53.   

The seladin-1 gene (Selective Alzheimer’s disease Indicator-1) was originally identified based on its selective down regulationof expression in regions of the brain vulnerable toAD relative to normal brains 54, 55. Increased seladin-1 expression acts as a protective agent against Aβ toxicity and oxidative stress inducing apoptosis 54.

A subsequent study demonstrated that the down-regulation of seladin-1 expression in vulnerable AD brain areas is paralleled by an increase in the amount of hyperphosphorylated tau, a protein component of neurofibrillary tangles 55. In the present study, a significant decrease in seladine-1 gene expression in the AD group when compared with negative control group with a significant improvement in the reduction of seladine-1 gene expression in the AD treated groups. MSCs alone exert a therapeutic effect against the brain lesion in Alzheimer’s disease possibly through decreasing the brain cholesterol level and increasing seladin-1 gene expression 31. These changes in seladin1 gene expression could be attributed for the antiapoptotic function exerted by conferring resistance against oxidative stress 56, while changes in seladin-1 gene expression in groups receiving milk kefir grain can be attributed to the anti-inflammatory and the hypolipidemic effect of kefir.

Neuropathological studies of AD brains reveal not only the presence of amyloid plaques and neurofibrillary tangles but also neuroinflammmatory changes involving astrocytes and activated microglia, which secrete inflammatory mediators including cytokines, chemokines, components of the complement system, and reactive oxygen species 57 . Individuals with AD or other acute inflammatory events (e.g., surgery or brain injury) exhibit increased levels of the pro-inflammatory cytokine tumor necrosis factor (TNF-α) 2- to 4-fold increase in the rate of cognitive decline 58. In our present work, there was a significant decrease in the mean IL-10 level and a significant increase in TNF-α level of LPS-induced AD when compared with the negative control. While in group III, IV, V and VI, there was a significant decrease in TNF-α with a significant improvement in IL-10 level. MSCs can also modulate activation and proliferation of T and B lymphocytes and alters their secretion profiles. They promote a strong anti-inflammatory T helper 2 (Th2) responses and inhibit deteriorating pro- inflammatory T helper cell type 1 (Th1) responses. Specifically, the MSCs caused mature DCs type 1(DC1) to decrease tumor necrosis factor α (TNF-α) secretion and mature DC2 to increase interleukin-10 (IL-10) secretion; MSCs caused Th1 cells to decrease interferon γ (IFN-γ) and caused the Th2 cells to increase secretion of IL-4; also MSCs caused an increase in the proportion of regulatory T cells (Treg) to more tolerant phenotype and decrease secretion of IFN-γ from the natural killer (NK) cells 59, 60 , reported that kefir significantly reduced glucose, lipid peroxide, level of cytokines and TNF-α level while enhancing IL-10, antioxidants capacity and normal pancreatic β cell expression. Kefir also has the  ability to activate regulator T cells (Treg) whose functions are  to maintain homeostasis of Th1-Th2, with suppressing  inflammation cytokines and increasing the production of interleukin-10 61. IL-10 suppresses pro-inflammatory response and apoptosis 62.

Dysregulation of cholesterol homeostasis in the brain has been linked to chronic neurodegenerative disorders, including Alzheimer’s disease (AD), Huntington’s disease (HD) and Parkinson’s disease (PD ) as well as to acute neuronal injuries such as stroke and brain trauma 63. In this recent study, there was significant increase in the mean brain tissue cholesterol in the LPS-induced AD when compared with the negative control group, while a significant decrease in brain cholesterol level was obtained in the treated groups 64, also observed that individuals with AD pathology have higher levels of total cholesterol as well as LDL. High levels of cholesterol would favor the cleavage of the APP by the beta and gamma secretases, which would produce the Aβ40 or Aβ42 peptides, which are thought to be responsible for AD pathology. Cholesterol is critical to brain growth, but high levels of cholesterol have been associated with neurogenerative disease.

Concerning the plasma lipid profile, Alzheimer’s disease occurs as secondary event related to atherosclerosis of extra cranial or intracranial vessels on the basis of brain hypo perfusion or discrete brain infraction. An alternative explanation is that atherosclerosis and Alzheimer’s disease are independent but act as a convergent disease processes 8.Hypercholesterolemia and inflammation have emerged as the dominant mechanisms implicated in the development of atherosclerosis, and have important interactions.Inflammation has been implicated in Alzheimer’s disease pathogenesis for over a decade, and increasing evidence suggests that abnormalities in cholesterol homeostasis could have an important role. Similarly, many of the contributory factors in atherogenesis have emerged as potential contributors in Alzheimer’s disease  8.

The high lights of our results concerning the plasma lipid profile give a quite clear indication that the plasma total cholesterol, LDL-CHO and TG levels were increased after the induction of AD with a co-current decrease in plasma HDL-CHO level, while there was decrease in plasma total cholesterol, LDL-CHO and TG levels of the AD treated groups with a co-current improvement in the reduction level of the plasma HDL-CHO level. MSCs act as anti-inflammatory agent by activating the macrophages to become phagocytotic and increase their lipid uptake to make foam cells 65. The effect of kefir in reducing lipid and cholesterol level could be attributed to the fact that the DE conjugation of bile acids by Lacto- bacillus spp, increasing the discharge of bile acids which in turn increases the expenditure of cholesterol to produce bile acids as well as precipitating cholesterol due to the low pH value of kefir 66,67.

Antioxidant enzymes are important in preventing an excessive accumulation of ROS. Membrane lipids present in subcellular organelles are highly susceptible to free radical damage. Malondialdehyde (MDA) is a by-product of lipid peroxidation induced by free radicals and is also widely used as a biomarker of oxidative stress 68. In the present study, there was a significant decrease in the mean GSH and a significant increase the MDA levels in the LPS-induced AD when compared with negative control group. The present study agrees with the work of 69, who tested the plasma malondialdehyde as a marker of lipid peroxidation to reflect the level of pathology in AD. In parallel, the level of reduced glutathione (GSH), which scavenges free radical species, was measured as an indicator of the antioxidant protection in 52 AD patients. It was reported that GSH levels were significantly reduced in AD compared to control subjects. Consistent with this, MDA levels were elevated in AD patients compared to controls. The present result revealed a significant improvement in the reduction of GSH level and a significant decrease in the MDA level in the AD treated groups. This agrees with the work of 70, who studied the effect of MSCs in an experimental model of arthritis. It was reported that administration of MSCs significantly decreased serum LDH, MDA and MPO enzymes with a significant increase in GSH of the MSCs group compared to the control group. Milk kefir supplementation identified potentially to reduce the MDA and improve the reduction of GSH level. Mechanism underlying is probably via its bioactive components such as; exopolyssacharides, peptide, antioxidant and immunomodulatory properties. This recent study is in accordance with the work of 60, where the lipid peroxidation was diminished by MDA reduction and suppression the level of pro-inflammatory cytokines (IL-10 & TNFα) of diabetic rat.  The novelty in our findings is that kefir was able to activate regulatory T cells (Tregs) whose functions are to maintain homeostasis of Th1-Th2 responses.

In this study, the histopathological examination of brain tissue showed no plaques but the cerebral cortex showed congestion in the blood vessels and focal gliosis. These findings agree with 35, who stated that BM-MSCs can promote the reduction of Aβ through the microglia activation in induced AD brain suggesting a potential therapeutic agent against AD. These findings also agree with 35,that transplanted BM-MSCs caused reduction in Aβ in LPS-induced AD in female albino rats. While milk Kefir grain activates Macrophage cells exposed to maintain immune cells in a state of homeostasis, through immunosuppression and immune modulating with decreased production of cytokines (IL1, IL6) and increased production of IL-10 while the role of IL-10 is to inhibit Th1 cells. Kefir also has the  ability to activate regulator T cells (Treg) whose functions are  to maintain homeostasis of Th1-Th2, with suppressing  inflammation cytokines and increasing the  production of interleukin-10 decreasing  61, IL10 suppress pro-inflammatory response and apoptosis 62.

In conclusion, these data revealed that milk Kefir grain either alone or associated with bone marrow derived MSCs exert a therapeutic effect on the brain lesion in Alzheimer’s disease possibly through acting as antiapoptotic ,anti-inflammatory, antihyperlipdemic and antioxidant as a mono or double therapy mixture.

Acknowledgement

Authors are very grateful Histology Department, Faculty of Medicine, Cairo University for their contributions to the histopathological studies of this work.

REFERENCES 

  • Danborg, P.B.; Simonsen, A.H.;Waldemar, G.; Heegaard,N.H,The potential of micro RNAs as bio fluid markers of neurodegenerative diseases a systematic review. Biomarkers; 2014;19: 259–268.
  • Kim, D. H.; Yeo, S. H.; Park, J. M.; Choi, J. Y.; Lee, T. H.; Park, S. Y.; et al., Genetic markers for diagnosis and pathogenesis of Alzheimer’s disease. Gene; 2014; 545, 185–193.
  • Bonda, D. J.; Lee, H. G.;Camins, A.; Pallas, M.;Casadesus, G.; Smith, M. A.; et al. The sirtuin pathway in ageing and Alzheimer disease: mechanistic and therapeutic considerations. Lancet Neurol; 2011;10: 275–279.
  • Demetrius, L.A; Driver, J., Alzheimer’s as a metabolic disease. Biogerontology; 2013;14:641–649.
  • Dineley, K.T.; Jahrling, J.B.; Denner,L,Insulin resistance in Alzheimer’s disease. Neurobiology Disease; 2014;72:92–103.
  • Femminella, G.D.; Edison,P., Evaluation of neuroprotective effect of glucagon-like peptide1analogs using neuroimaging. Alzheimer’s Dementia; 2013;10(1): 55–61.
  • Femminella, G.D.; Rengo,G.; Komici, K.; Iacotucci, P.; Petraglia, L.; Pagano, G.; de Lucia, C.; Canonico, V.; Bonaduce, D.; Leosco, D.; Ferrara, N. Autonomic dysfunctionin Alzheimer’s disease: tools for assessment and review of the literature. J. Alzheimer’s Dis.; 2014; 42:369–377.
  • Casserly, I. and Topol, E., Convergence of atherosclerosis and Alzheimer’s disease: inflammation, cholesterol, and misfolded proteins. Lancet; 2004;363(9415):1139–46.
  • Akiyama, H.; Barger, S.; Barnum, S.; Bradt, B.; Bauer, J.; Cole, G.M.; Cooper, N.R.; Eikelenboom, P.; Emmerling, M.; Fiebich, B.L.; Finch, C.E.; Frautschy, S.; Griffin, W.S.; Hampel, H.; Hull, M.; Landreth, G.; Lue, L.; Mrak, R.; Mackenzie, I.R.; McGeer, P.L.; O’Banion, M.K.; Pachter, J.; Pasinetti, G.; Plata-Salaman, C.; Rogers, J.; Rydel, R.; Shen, Y.; Streit, W.; Strohmeyer, R.; Tooyoma, I.; Van Muiswinkel, F.L.; Veerhuis, R.; Walker, D.;Webster,S.;Wegrzyniak, B.; Wenk, G.; Wyss-Coray,T.,Inflammation and Alzheimer’s disease. Neurobiology of aging; 2000;21:383–421.
  • Behl, C.; Davis JB.; Lesley,; Schubert, D., Hydrogen peroxide mediates amyloid beta protein toxicity; Cell 1994;77:817-827.
  • Pappolla, M.A.; Smith, M.A.; Bryant-Thomas, T.; Bazan, N.; Petanceska, S.; Perry, G. Cholesterol, oxidative stress, and Alzheimer’s disease: expanding the horizons of pathogenesis. Free Radical Biol Med; 2002;33:173–81.
  • Ebert, A.D.; Beres, A.J.; Barber, A.E.; Svendsen, C.N., Human neural progenitor cells overexpressing IGF-1 protect dopamine neurons and restore function in a rat model of Parkinson’s disease. ExpNeurol; 2008;209: 213–223.
  • Lu, P.; Jones, L.L.; Snyder, E.Y.; Tuszynski, M.H. Neural stem cells constitutively secrete neurotrophic factors and promote extensive host axonal growth after spinal cord injury. ExpNeurol; 2003;181: 115–129.
  • Park, K.I.; Himes, B.T.; Stieg, P.E.; Tessler, A.; Fischer, I., et al. ,Neural stem cells may be uniquely suited for combined gene therapy and cell replacement:Evidence from engraftment of Neurotrophin-3-expressing stem cells in hypoxicischemic brain injury. ExpNeurol; 2006; 199: 179–190.
  • Blurton-Jones M.; Kitazawa M.; Martinez-Coria H.; Castello NA.; Müller FJ.; Loring JF.; Yamasaki TR.; Poon WW.; Green KN.; LaFerla FM., Neural stem cells improve cognition via BDNF in a transgenic model of Alzheimer disease. ProcNatlAcadSci U S A. 2009;106(32):13594-9.
  • Lee, JK.; Jin, H.K.; Endo, S.; Schuchman, E.H.; Carter, J.E.; et al., Intracerebral transplantation of bone marrow-derived mesenchymal stem cells reduces amyloid-beta deposition and rescues memory deficits in Alzheimer’s disease mice by modulation of immune responses. Stem Cells; 2010;28: 329–343.
  • Rodrigues, K.L.; Carvalho, J.C.T.; Schneedorf, J.M., Anti-inflammatory properties of kefir and its polysaccharide extract. Inflammopharmacology; 2005;13(5-6):485–92.
  • Micheli, L.; Uccelletti, D.; Palleschi, C.; Crescenzi, V. ,Isolation and characterization of a ropy Lactobacillus strain producing the exopolysaccharidekefiran, Appl. Microbiol. Biotechnol; 1999;53:69–74.
  • Hallé, C.; Leroi, F.; Dousset, X.; Pidoux, M., Les kéfirs : des associations bactérieslactiques- levures. In Roissart, De H., Luquet, F.M. (Eds.), Bactérieslactiques: Aspects fondamentauxettechnologiques. Vol. 2. Uriage, France, Lorica, 1994;169-182.
  • Jaiswal, N.; Haynesworth, S.E.; Caplan, A.I.; Bruder, S.P., Os-teogenic differentiation of purified culture-expanded human mesenchymal stem cells in vitro. Journal of cellular biochemistry; 1997; 64(2): 295–312.
  • Liu, J.; Wang, S.; Lin, Y.; Lin, C., Antitumor Activity of Milk Kefir and Soy Milk Kefir in Tumor-Bearing Mice; Nutrition and cancer; 2009; 44(2):182–187.
  • Nesrine S. El Sayed.; Lobna A. Kassem.; Ola A. Heikal.(2009):Promising therapy for Alzheimer’s disease targeting angiotensin converting enzyme and the cyclooxygense-2 isoform. Drug DiscovTher; 3(6):307-315.
  • P.; Soltani, T.B.; Alizadeh, A., Transplanted Bone Marrow mesenchymal Stem Cells Improve Memory in Rat Models of Alzheimer’s disease. Stem Cells International; 2012; 369417 (8).
  • Shoji, H.; Hagihara, H.; Takao, K.; Hattori, S.; Miyakawa, T., T-maze forced alternation and left-right discrimination tasks for assessing working and reference memory in mice. J Vis Exp; 2012; 26(60):3300.
  • Bradford, M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry; 1974;72: 248–254.
  • Bancroft JD, Stevens A, Turner DR , Theory and practice of histological techniques; 1994; 25-90.
  • Poulsom, R.; Forbes, S.J.; Hodivala-DHke, K.; Ryan, E., et al., Bone marrow contributes to renal parenchymal turnover and regenera- tion. J Pathol; 2002; 195:229-35.
  • Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D., et al. Multilineage potential of adult human mes- enchymal stem cells. Science; 1999;284: 143-7.
  • Imai, E.; Ito, T., Can bone marrow differentiate into renal cells. PediatrNephrol; 2002; 17:790-4.
  • Choi, S. S.; Lee, S.; Kim, S. U.; Lee, H. J., Alzheimer’s disease and Stem Cell Therapy; 2014; 23(1):45–52.
  • Ahmed, Z.; Wang, Y.; Ahmad, A.; Khan, S.T.; Nisa, M.; Ahmad, H.; Afreen, A. Kefir and health: a contemporary perspective. Critical reviews in food science and nutrition; 2013; 53(5): 422–34.
  • Garrote, G.L.; Abraham, A.G.; De Antoni,G. Microbial Interactions in Kefir: A Natural Probiotic Drink. In F. Mozzi, R.R. Raya and G. M. Vignolo (Eds.), Biotechnology of Lactic Acid Bacteria – Novel Applications. Iowa: Blackwell Publishing: 2010; 327-340.
  • Monje, M. L.; Toda, H.; Palmer, T. D. Inflammatory blockade restores adult hippocampal neurogenesis. Science; 2003; 302;1760-5.
  • Ekdahl, C. T.; Claasen, J. H.; Bonde, S.; Kokaia, Z.; Lindvall, O. Inflammation is detrimental for neurogenesis in adult brain. ProcNatlAcad; 2003; 100:13632-13637.
  • Lee, R.H.; Pulin, A.A.; Seo, M.J.; Kota, D.J.; Ylostalo, J.; Larson, B.L.;Semprun-Prieto, L.; Delafontaine, P.; Prockop, D.J. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell; 2009; 5:54–63.
  • Van Velthoven, C.T.; Kavelaars, A.; van Bel, F. Mesenchymal stem cell trans- plantation changes the gene expression profile of the neonatal ischemic brain. Brain Behav. Immun; 2011; 25:1342–1350.
  • Kokaia, Z.; Martino, G.; Schwartz, M.; Olle, Lindvall. Cross-talk between neural stemcells and immune cells: the key to better brain repair? Nat. Rev. Neurosci; 2012; 15:1078–1087.
  • Chir, A. I.; Iskender, A.; Erdem, H.; Ankatali, H.; Kandis, H. The early anti-inflammatory effect of Kefir in experimental corrosive esophagitis. Ann ItalChir; 2013; 84(6):681-85.
  • Gravel, C.; Götz, R.; Lorrain, A.; Sendtner M., Adenoviral gene transfer of ciliaryneurotrophic factor and brain-derived neurotrophic factor leads to long-term survival of axotomized motor neurons. Nat Med; 1997; 3:765–70.
  • Thoenen, H. Neurotrophins and neuronal plasticity. Science; 1995; 270(5236):593-98.
  • Cheng, H.; Wu, J.P.; Tzeng, S.F. Neuroprotection of glial cell line-derived neurotrophic factor in damaged spinal cords following contusive injury. J Neurosci Res2002;1; 69(3): 397-405.
  • Jin, K.; LaFevre-Bernt, Sun, Y.;Chen, S.; Gafni, J.; Crippen, D.; Logvinova, A.; Ross, C.A.; Greenberg, D.A.; Ellerby, L.M ,FGF-2 promotes neurogenesis and neuroprotection and prolongs survival in a transgenic mouse model of Huntington’s disease. ProcNatlAcadSci; 2005; 102: 18189-18194.
  • Schabitz,W.R.; Sommer, C.; Zoder, W.; Kiessling, M.; Schwaninger, M.; Schwab, S.,Intravenous brain-derived neurotrophic factor reduces infarct size and counter regulates Bax and Bcl-2 expression after temporary focal cerebral ischemia. Stroke; 2005; 31: 2212-2217.
  • Wang, P.; Xie, Z.H.; Guo, Y.J. VEGF-induced angiogenesis ameliorates the memory impairment in APP transgenic mouse model of Alzheimer’s disease. Biochemical and Biophysical Research Communications; 2011; 411:620–626.
  • Chen, X.; Li, Y.; Wang, L.; Katakowski, M.; Zhang, L.; Chen, J.; Xu, Y.; Gautam, S.C.; Chopp, M.,Ischemic rat brain extracts induce human marrow stromal cell growth factor production. Neuropathology; 2002; 22(4): 275-79.
  • Jiang, J.; Lv, Z.; Gu, Y.; Li, J.; Xu, L.; Xu, W.; Lu, J.; Xu, J. Adult rat mesenchymal stem cells differentiate into neuronal- like phenotype and express a variety of neuro-regulatory molecules in vitro. Neuroscience Res; 2010; 66(1): 46-52.
  • Labouyrie, E.; Dubus, P.; Groppi, A.; Mahon, FX.; Ferrer, J.; Parrens, M.; Reiffers, J.; De Mascarel, A.; Merlio, JP. Expression of neurotrophins and their receptors in human bone marrow. Am J Pathol; 1999; 154: 405–15.
  • Neuhuber, B.; Gallo, G.; Howard, L.; Kostura, L.; Mackay, A.; Fischer, I. Reevaluation of in vitro differentiation protocols for bone marrow stromal cells: disruption of actin cytoskeleton induces rapid morphological changes and mimics neuronal phenotype. J Neurosci Res; 2004; 77(2):192-204.
  • Bercik, p.; Verdu, E.F.; Foster, J.A.; Macri, J.; Potter, M.; Huang, X.; Malinowski, P.; Jackson, W.; Blennerhassett, P.; Neufeld, K.A.; Lu, J.; Khan, W.I.; Corthesy-Theulaz, I.; Cherbut, C.; Bergonzelli, G.E.; Collins S.M. Chronic gastrointestinal inflammation induces anxiety-like behavior and alters central nervous system biochemistry in mice. Gastroenterology; 2010; 139:2102–2112.
  • Gareau, M.G.; Wine, E.; Rodrigues, D.M.; Cho, J.H.; Whary, M.T.; Philpott, D.J.; Macqueen, G.; Sherman, P.M. Bacterial infection causes stress-induced memory dysfunction in mice. Gut; 2010; 60: 307–317.
  • Ostrovskaya, R.U.; Gruden, M.A.; Bobkova, N.A.; Sewell, R.D.; Gudasheva, T.A. The nootropic and neuroprotectiveproline-containing dipeptide noopept restores spatial memory and increases immune reactivity to amyloid in an Alzheimer’s disease model. J Psychopharmacol; 2007;21(6):611-9.
  • Jin, G.; Qiu, G.; Wu, D.; Hu, Y.; Qiao, P.; Fan, C.; Gao, F., Allogeneic bone marrow-derived mesenchymal stem cells attenuate hepatic ischemia-reperfusion injury by suppressing oxidative stress and inhibiting apoptosis in rats. Int J Mol Med; 2013;31:1395–1401.
  • Oda, K.; Arakawa, H.; Tanaka, T.; Matsuda, K.; Tanikawa, C.; Mori, T.; Shirahata, S. p53AIP1, a potential mediator of p53-dependent apoptosis, and its regulation by Ser- 46-phosphorylated. Cell; 2000; 102(6):849-862.
  • Greeve, I.;Hermans-Borgmeyer, I.; Brellinger, C.;Kasper, D.; Gomez-Isla, T.; Behl, C.; Levkau, B.; Nitsch, R.M, The human Diminto/Dwarf1 homolog seladin-1 confers resistance to Alzheimer’s disease-associated neurodegeneration and oxidative stress. J Neurosci; 2000; 20:7345–7352.
  • Iivonen, S.; Hiltunen, M.; Alafuzoff, I.; Mannermaa, A.; Kerokoski, P.; Puoliva, li.J.; Salminen, A.; Helisalmi, S.; Soininen, H. Seladin-1 transcription is linked to neuronal degeneration in Alzheimer’s disease. Neuroscience; 2002;113:301–310.
  • Di Stasi, D.; Vallacchi, V.; Campi, T.; Ranzani, M.; Daniotti, E.; Chiodini,S.; Fiorentini, I.; Greeve, A.; Prinetti, L.; Rivoltini, M. A.; Pierotti, M.A.; Rodolfo,M., DHCR24 gene expression is up regulated in melanoma metastases and associated to resistance to oxidative stress-induced apoptosis. Int. J. Cancer; 2005; 115:224–230.
  • Heneka, M.T. and O’Banion, M.K. Inflammatory processes in Alzheimer’s disease. J Neuroimmunol; 2007; 184:69-91.
  • Holmes, C.; Cunningham, C.; Zotova, E.; Woolford, J.; Dean, C.; Kerr, S.; Culliford, D.; Perry, V.H. Systemic inflammation and disease progression in Alzheimer disease. Neurology; 2009; 73:768–774.
  • Drela, K.; Siedlecka, P.; Sarnowska, A.; Domanska-janik, K. Human mesenchymal stem cells in the treatment of neurological diseases; 2013; 38–56.
  • Judiono, Djokomoeljanto,R. and Hadisaputro,S. Biomolecular aspects of plain Kefirpotenials. International Journal of Food, Nutrition and Public Health; 2012; 5(1/2).
  • Susetia-Totoprajogo, O. Probiotic and gut immune system. Makalah Malang Nutrition. 2010
  • Dronavalli, S.; Duka, I.; Bakris, G.L. The pathogenesis of diabetic nephropathy. Nat ClinPractEndocrinolMetab; 2008; 4(8): 444–452.
  • Vance, J.E, Dysregulation of cholesterol balance in the brain contribution to neurodegenerative diseases. Dis. Model.Mech; 2012; 5(6):746-755.
  • Searcy, J.L. Lipid Signaling in Brain Aging and Alzheimer’s Disease : Pharmacologically Targeting Cholesterol Synthesis, Transport and Metabolism. University of Kentucky Doctoral Dissertations. Paper; 2009;
  • El-Tantawy, W. H. and Haleem, E. N. A. Al., Therapeutic effects of stem cell on hyperglycemia, hyperlipidemia, and oxidative stress in alloxan-treated rats. Molecular and Cellular Biochemistry; 2014; 391(1-2):193–200.
  • Brashears M. M.; Gilliland S. E.; Buck L. M. ,Bile salt deconjugation and cholesterol removal from media by Lactobacillus casei. J. Dairy Sci; 1998; 81: 2103-2110.
  • Tamai, Y.; Yoshimitsu N.; Watanabe. Y.; Kuwabara, Y.; Nagai, S., ffects of milk fermented by culturing with varius lactic acid bacteria and yeast on serum cholesterol level in rats. J. Ferment. Journalof Fermentation and Bioengineering; 1996;81:181–182.
  • Sultana, R.; Cenini, G.;Butterfield, D., Biomarkers of Oxidative Stress in Neurodegenerative Diseases. Basis of Oxidative Stress. Chemistry, Mechanisms, and Disease Pathogenesis (ed F. A. Villamena), John Wiley & Sons, Inc., Hoboken, NJ, USA. doi: 2013;1002/9781118355886.ch14
  • Gustaw-Rothenberg ,K.; Lerner, A.; Bonda, D.J.; Lee, H.G.; Zhu, X.; Perry, G.; Smith, M.A. Biomarkers in Alzheimer’s disease ; past ,present and future , Bio mark Med; 2010;4(1):15-26.
  • El-denshary, E.S.M.; Rashed, L.A.; Elhussiny, M., Immunosuppressive Effects of Mesenchymal Stem Cells versus Corticosteroid in Experimental Model of Arthritis. ClinExpPharmacol; 2005;5:003.
  • Judiono, Djokomoeljanto,R. and Hadisaputro,S. Biomolecular aspects of plain Kefirpotenials. International Journal of Food, Nutrition and Public Health; 2012;5(1/2).
  • Lee, R.H.; Pulin, A.A.; Seo, M.J.; Kota, D.J.; Ylostalo, J.; Larson, B.L.;Semprun-Prieto, L.; Delafontaine, P.; Prockop, D.J.,Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell; 2009; 5:54–63.
  • Susetia-Totoprajogo, O., Probiotic and gut immune system. Makalah Malang Nutrition. 2010;
  • Dronavalli, S.; Duka, I.; Bakris, G.L., The pathogenesis of diabetic nephropathy. Nat ClinPractEndocrinolMetab; 2008;4(8): 444–452.